vector pj98 (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
vector pj98
Vector Pj98, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cmv+brainbow+1+1/CMV-Brainbow-2%2E1+R+(Plasmid+%2318723)/pmc12509891-376-14-16
Average 93 stars, based on 20 article reviews
Vector Pj98, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cmv+brainbow+1+1/CMV-Brainbow-2%2E1+R+(Plasmid+%2318723)/pmc12509891-376-14-16
Average 93 stars, based on 20 article reviews
vector pj98 - by Bioz Stars,
2026-10
93/100 stars
Images
Related Articles
Construct:Article Title: A mutant retroviral receptor restricts virus superinfection interference and productive infection Article Snippet: .. To construct a vector genome expressing fluorescent cherry red protein, RFP, the GFP gene in the retroviral vector, pRT43.2 GFP [ ] was removed by digesting with PmlI (blunted) and NotI and this fragment was removed and replaced with RFP gene that was obtained from Plasmid Preparation:Article Title: A mutant retroviral receptor restricts virus superinfection interference and productive infection Article Snippet: .. To construct a vector genome expressing fluorescent cherry red protein, RFP, the GFP gene in the retroviral vector, pRT43.2 GFP [ ] was removed by digesting with PmlI (blunted) and NotI and this fragment was removed and replaced with RFP gene that was obtained from Article Title: Determinants of effective lentivirus-driven microRNA expression in vivo Article Snippet: .. Schematic workflow of lentiviral DNA plasmid; (viii) Pabp family expression vector (Steps (1)-(9)) Step (1) Annealing of oligoDNAs (BamHI end)-(SbfI)-(AscI)-(XbaI)-(BstBI)-(NheI)-(AsiSI)-(EcoRI end) GATCCCCTGCAGGGGCGCGCCTCTAGATTCGAAGCTAGCGGCGCGCCG (EcoRI end)-(AsiSI)-(NheI)-(BstBI)-(XbaI)-(AscI)-(SbfI)-(BamHI end) AATTCGGCGCGCCGCTAGCTTCGAATCTAGAGGCGCGCCCCTGCAGGG Step (2) Enzyme Digestion (BamHI/EcoRI) of EF1a-EGFP/FUGW Step (3) Ligation Step (1) and Step (2), and transformation Step (4) PCR, and enzyme digestion(BamHI/EcoRI) Template : Article Title: G-protein-coupled receptor kinase 2 terminates G-protein-coupled receptor function in steroid hormone 20-hydroxyecdysone signaling. Article Snippet: .. Cells overexpressed ErGPCR-2-CFP-His, GRK2-YFP-His and ErGPCR-2-CFP-His+ GRK2-YFP-His for 48 h. The cyan fluorescent protein (CFP) and yellow fluorescent protein (YFP) were cloned from a Article Title: G-protein-coupled receptor kinase 2 terminates G-protein-coupled receptor function in steroid hormone 20-hydroxyecdysone signaling Article Snippet: We used the Phosphoprotein phosphate estimation assay kit (Sangon Biotech, Shanghai, China) to detect the number of moles of phosphorus per mole of GRK2-GFP-His, GRK2 T672A -GFP-His or GRK2 S680A -GFP-His based on the alkaline hydrolysis of phosphate from seryl and threonyl residues in phosphoproteins. .. Cells overexpressed ErGPCR-2-CFP-His, GRK2-YFP-His and ErGPCR-2-CFP-His+GRK2-YFP-His for 48 h. The cyan fluorescent protein (CFP) and yellow fluorescent protein (YFP) were cloned from a Expressing:Article Title: A mutant retroviral receptor restricts virus superinfection interference and productive infection Article Snippet: .. To construct a vector genome expressing fluorescent cherry red protein, RFP, the GFP gene in the retroviral vector, pRT43.2 GFP [ ] was removed by digesting with PmlI (blunted) and NotI and this fragment was removed and replaced with RFP gene that was obtained from Article Title: Determinants of effective lentivirus-driven microRNA expression in vivo Article Snippet: .. Schematic workflow of lentiviral DNA plasmid; (viii) Pabp family expression vector (Steps (1)-(9)) Step (1) Annealing of oligoDNAs (BamHI end)-(SbfI)-(AscI)-(XbaI)-(BstBI)-(NheI)-(AsiSI)-(EcoRI end) GATCCCCTGCAGGGGCGCGCCTCTAGATTCGAAGCTAGCGGCGCGCCG (EcoRI end)-(AsiSI)-(NheI)-(BstBI)-(XbaI)-(AscI)-(SbfI)-(BamHI end) AATTCGGCGCGCCGCTAGCTTCGAATCTAGAGGCGCGCCCCTGCAGGG Step (2) Enzyme Digestion (BamHI/EcoRI) of EF1a-EGFP/FUGW Step (3) Ligation Step (1) and Step (2), and transformation Step (4) PCR, and enzyme digestion(BamHI/EcoRI) Template : Retroviral:Article Title: A mutant retroviral receptor restricts virus superinfection interference and productive infection Article Snippet: .. To construct a vector genome expressing fluorescent cherry red protein, RFP, the GFP gene in the retroviral vector, pRT43.2 GFP [ ] was removed by digesting with PmlI (blunted) and NotI and this fragment was removed and replaced with RFP gene that was obtained from Ligation:Article Title: Determinants of effective lentivirus-driven microRNA expression in vivo Article Snippet: .. Schematic workflow of lentiviral DNA plasmid; (viii) Pabp family expression vector (Steps (1)-(9)) Step (1) Annealing of oligoDNAs (BamHI end)-(SbfI)-(AscI)-(XbaI)-(BstBI)-(NheI)-(AsiSI)-(EcoRI end) GATCCCCTGCAGGGGCGCGCCTCTAGATTCGAAGCTAGCGGCGCGCCG (EcoRI end)-(AsiSI)-(NheI)-(BstBI)-(XbaI)-(AscI)-(SbfI)-(BamHI end) AATTCGGCGCGCCGCTAGCTTCGAATCTAGAGGCGCGCCCCTGCAGGG Step (2) Enzyme Digestion (BamHI/EcoRI) of EF1a-EGFP/FUGW Step (3) Ligation Step (1) and Step (2), and transformation Step (4) PCR, and enzyme digestion(BamHI/EcoRI) Template : Transformation Assay:Article Title: Determinants of effective lentivirus-driven microRNA expression in vivo Article Snippet: .. Schematic workflow of lentiviral DNA plasmid; (viii) Pabp family expression vector (Steps (1)-(9)) Step (1) Annealing of oligoDNAs (BamHI end)-(SbfI)-(AscI)-(XbaI)-(BstBI)-(NheI)-(AsiSI)-(EcoRI end) GATCCCCTGCAGGGGCGCGCCTCTAGATTCGAAGCTAGCGGCGCGCCG (EcoRI end)-(AsiSI)-(NheI)-(BstBI)-(XbaI)-(AscI)-(SbfI)-(BamHI end) AATTCGGCGCGCCGCTAGCTTCGAATCTAGAGGCGCGCCCCTGCAGGG Step (2) Enzyme Digestion (BamHI/EcoRI) of EF1a-EGFP/FUGW Step (3) Ligation Step (1) and Step (2), and transformation Step (4) PCR, and enzyme digestion(BamHI/EcoRI) Template : Polymerase Chain Reaction:Article Title: Determinants of effective lentivirus-driven microRNA expression in vivo Article Snippet: .. Schematic workflow of lentiviral DNA plasmid; (viii) Pabp family expression vector (Steps (1)-(9)) Step (1) Annealing of oligoDNAs (BamHI end)-(SbfI)-(AscI)-(XbaI)-(BstBI)-(NheI)-(AsiSI)-(EcoRI end) GATCCCCTGCAGGGGCGCGCCTCTAGATTCGAAGCTAGCGGCGCGCCG (EcoRI end)-(AsiSI)-(NheI)-(BstBI)-(XbaI)-(AscI)-(SbfI)-(BamHI end) AATTCGGCGCGCCGCTAGCTTCGAATCTAGAGGCGCGCCCCTGCAGGG Step (2) Enzyme Digestion (BamHI/EcoRI) of EF1a-EGFP/FUGW Step (3) Ligation Step (1) and Step (2), and transformation Step (4) PCR, and enzyme digestion(BamHI/EcoRI) Template : Article Title: Clonal identity determines astrocyte cortical heterogeneity. Article Snippet: .. To achieve this, primers containing a 50 BamHI and 30 EcoRI site were used to amplify mTSapphire from pRSET-mtSapphire (kindly provided by Dr Griesbeck) by PCR, and the remaining products from Clone Assay:Article Title: G-protein-coupled receptor kinase 2 terminates G-protein-coupled receptor function in steroid hormone 20-hydroxyecdysone signaling. Article Snippet: .. Cells overexpressed ErGPCR-2-CFP-His, GRK2-YFP-His and ErGPCR-2-CFP-His+ GRK2-YFP-His for 48 h. The cyan fluorescent protein (CFP) and yellow fluorescent protein (YFP) were cloned from a Article Title: G-protein-coupled receptor kinase 2 terminates G-protein-coupled receptor function in steroid hormone 20-hydroxyecdysone signaling Article Snippet: We used the Phosphoprotein phosphate estimation assay kit (Sangon Biotech, Shanghai, China) to detect the number of moles of phosphorus per mole of GRK2-GFP-His, GRK2 T672A -GFP-His or GRK2 S680A -GFP-His based on the alkaline hydrolysis of phosphate from seryl and threonyl residues in phosphoproteins. .. Cells overexpressed ErGPCR-2-CFP-His, GRK2-YFP-His and ErGPCR-2-CFP-His+GRK2-YFP-His for 48 h. The cyan fluorescent protein (CFP) and yellow fluorescent protein (YFP) were cloned from a |